 | Overview and Learning Objectives
In this activity, students work with a model that shows the entire process from gene transcription and translation, through protein folding of the newly synthesized protein.
Students will be able to:
- reason how DNA, a linear polymer made of four different types of monomers (adenine, thymine, guanine, and cytosine), can store the genetic code: information about sequence of amino acids in proteins;
- describe the processes of translation and transcription;
- compare the structure, location, and function of RNA and DNA;
- manipulate the DNA code and observe how it changes the sequence of m-RNA and proteins.
return to top
|
|
|
|
|
|
 | Assessment
TEST
http://www.concord.org/~barbara/workbench_web/pdf/DNA_to_Protein8.07.pdf
RUBRIC
http://www.concord.org/~barbara/workbench_web/pdf/DNA_to_Protein_Rubric.8.07a.pdf
return to top
|
|
|
|
|
|
|
 | Classroom Practice
Solution For Designer Challenge 4:
TTTTTTTTTGATTTTGATTTTGATTTTGATTTTTTTTTT
Solution for page 5:
GATGATGATTTTTTTTTTTTTTTTTTTTTTCATCATCAT
return to top
|
|
|
|
|
|
|
 | Central Concepts
Key Concept:
The sequence of nucleotides in the DNA serves as a genetic code, dictating the sequence of amino acids in proteins.
Additional Related Concepts
Biology Molecular Biology
return to top
|
|
|
|
|
|
|
 | Textbook References
- Biology (Miller and Levine) Prentice Hall 5th Edition - Unit 2: Chapter 10 - Genes and Chromosomes
- Biology (Miller and Levine) Prentice Hall 5th Edition - Unit 2: Chapter 7 - Nucleic Acids and Protein Synthesis
- Biology (Prentice-Hall) New York Edition - Chapter 12: DNA and RNA
- Biology (Prentice-Hall) New York Edition - Chapter 16: Evolution
- Biology (Prentice-Hall) New York Edition - Chapter Seven: Cell Structures and Functions
- Biology: Concepts and Connections (Pearson) 5th Ed. - Chapter 3: The Molecules of Cells
- Biology: Concepts and Connections (Pearson) 5th Edition - Chapter 10: Molecular Biology of the Gene
- Biology: Concepts and Connections (Pearson) 5th Edition - Chapter 12: DNA Technology and the Human Genome
- Biology: Concepts and Connections (Pearson) 5th Edition - Chapter 4: A Tour of the Cell
- Biology: Exploring Life - Chapter 11: DNA and the Language of Life
- Biology: The Dynamics of Life - Chapter 11: DNA and Genes
- BSCS Blue (8th Edition) - Chapter 12: Reproduction
- BSCS Human - Chapter 12: Gene Action
- Cell Biology (Pollard and Earnshaw) Saunders 2002 - Chapter 11: Introduction to Nuclear and chromosomal Structure and Function
- Cell Biology (Pollard and Earnshaw) Saunders 2002 - Chapter 18: Protein Synthesis and Folding in the Cytoplasm
- Web of Life - Chapter 7: DNA, Genes and Chromosomes
return to top
|
|
|
|
|
|
|
 | Benchmarks and Standards
AAAS - THE LIVING ENVIRONMENT: CELLS - The genetic information encoded in DNA molecules provides instructions for assembling protein molecules (Full Text of Standard)
NSES - Life Science: Heredity Molecular Basis - 1 In all organisms, the instructions for specifying the characteristics of the organism are carried in DNA (Full Text of Standard)
- Life Science: The Cell - 3 Cells store and use information to guide their functions (Full Text of Standard)
return to top
|
|
|
|
|
|
|
 | Extensions and Connections
The flash interactive animation included as a link in this activity stands on its own as a learning tool.
http://molo.concord.org/database/activities/273.html
A logical next activity is Mutations
return to top
|
|
|
|
|
|
|
 | Additional Info
Additional Background
- DNA Interactive (Howard Hughes and Cold Spring Harbor)
http://www.dnai.org/index.htm
Allows students to follow the footsteps of Crick and Watson as they discover DNA. Flash
- An excellent DNA tutorial done in Chime:
http://www.dnai.org/a/index.html
http://molvis.sdsc.edu/dna/moredna.htm
return to top
|
|
|
|
|
|
|
 | Activity Credits
Created by CC Project: Molecular Logic using Molecular Workbench
return to top
|
|
|
|
|
|
|
 | Requirements
- Java 1.5+ - Java 1.5+ is available for Windows, Linux, and Mac OS X 10.4 and greater.
If you are using Mac OS X 10.3, you can download MW Version 1.3 and explore within it instead.
return to top
|
|
|
|
|
|
|
Interactive, scaffolded model
Go To Activity